Bacterial strains, cultivation conditions and biomass harvest

T. linaloolentis 47Lol was cultivated under anaerobic, denitrifying conditions in artificial fresh water (AFW) medium. Medium was prepared as described by Foss et al. [29] with modifications: carbonate buffer was replaced by 10 mM Na₂HPO₄/NaH₂PO₄ and vitamins were omitted. The headspace contained only nitrogen gas. 1–2 mM (R,S)-linalool (>97 % purity; Sigma-Aldrich, Germany) were directly applied without carrier phase as sole carbon and energy source. Cultures were incubated at 28 °C under mild shaking (60 rpm). Alternatively, they were stirred. Bacterial biomass for protein purification was obtained from 2 L cultures grown on 2 mM linalool and 20 mM nitrate by centrifugation (16000 × g, 25 min, 4 °C). If not used directly, biomass was frozen in liquid nitrogen and stored at −80 °C.

Purification attempts by chromatography

First attempts on the purification of the linalool isomerase were performed by classical column chromatography using anion exchange and hydrophobic interaction columns (DEAE; binding buffer: 80 mM Tris-Cl, pH 9.5, elution buffer: 80 mM Tris-Cl, pH 9.5 with 1 M NaCl; Phenyl Sepharose; binding buffer: 80 mM Tris-Cl, pH 8.0 with 10 % v/v of a saturated ammonium sulfate solution, elution buffers: 80 mM Tris-Cl, pH 8.0 and water). Size-exclusion chromatography was performed on a HiLoad 16/60 Superdex200 column (GE healthcare, dimensions: 16 × 600 mm; 20 mM KH₂PO₄/K₂HPO₄, pH 8.0 with or without 6 M urea). Calibration was performed with thyroglobulin (670 kDa), bovine gamma-globulin (158 kDa), chicken ovalalbumin (44 kDa), equine myoglobin (17 kDa) and vitamin B12 (1.35 kDa).

Soluble protein extract was prepared by resuspending biomass in Tris-Cl buffer (80 mM, pH 9.5 for DEAE and pH 8.0 for HIC) and fast thawing at room temperature. Cell disintegration was performed by mechanical sheering using a One-Shot cell disruptor (Constant Systems Ltd., Daventry, UK) at 1.7 GPa two times. The crude extract was clarified by ultracentrifugation (150000 × g, 30 min, 4 °C).

All purification steps were performed on ice or at 5 °C. SDS-PAGE was used to characterize purification samples and protein concentrations were determined according to the method described by Bradford using bovine serum albumin as a calibration standard [30].

Spheroplast preparation

Spheroplasts were prepared according to the protocol for subcellular fractionation described by Koßmehl et al. [31]. Cells were washed with 1.5 M NaCl solution, collected by centrifugation (14200 × g, 20 min, 4 °C) and resuspended in 20 % (w/v) sucrose, 30 mM Tris-Cl (pH 8.0) and 2 mM EDTA for osmotic shock treatment. The cell suspension was incubated for 20 min at 30 °C. A spheroplast enriched pellet was formed by centrifugation (14200 × g, 20 min, 4 °C). The pellet was resuspended in 5 mL of ice-cold 40 mM Tris-Cl (pH 8.0) and disintegrated by a One Shot Cell Disruptor (Constants Systems Ltd., UK) in two passages at 1.7 GPa. After removal of larger cell debris and unbroken cells by centrifugation (14200 × g, 20 min), the supernatant was further clarified by ultracentrifugation (104000 × g, 1 h, 4 °C). The resulting pellet and supernatant corresponded to an inner membrane fraction (IM, F7, Additional file 1: Figure S1) and a soluble protein fraction (SP, F6, Additional file 1: Figure S1), respectively.

Sucrose density gradient centrifugation

A linear sucrose gradient was created by overlaying a 20 % (w/v) over a 70 % (w/v) sucrose solution, 3 mL each. The tubes were incubated horizontally for 90 min to allow mixing. A 1 mL-protein sample was loaded carefully on top of the gradient and centrifugation was performed in a L-70 ultracentrifuge (70.1Ti rotor, Beckmann Coulter) at 260000 × g, for 4 h at 4 °C, with slow acceleration and deceleration. The linearity of the sucrose gradient was confirmed by gravimetrical measurement. 1 mL fractions covering the gradient were analyzed for enzyme activity and for protein content on SDS-PAGE. The two most active fractions were pooled, diluted with 40 mM Tris-Cl (pH 8.0) to a final volume of 8 mL and a second ultracentrifugation step (260000 × g, 4 °C, 1.5 h ≡ 42 Svedberg) was performed to remove sucrose. This resulted in the formation of a protein pellet enriched in Lis activity, which was resuspended in 1 mL buffer and used for the characterization of the enzyme kinetic.

Proteomics by MALDI-ToF MS

Protein samples, obtained from individual purifications, were analyzed by SDS-PAGE coupled with matrix-assisted laser desorption/ionization time of flight (MALDI-ToF) mass spectrometry (MS). Protein bands in gels were excised manually, and the Ettan Spot Handling Workstation (GE Healthcare) was used for trypsin digestion and embedding of the resulting peptide solutions in an α-cyano-4-hydroxycinnamic acid matrix for spotting onto MALDI targets. MALDI-ToF MS analysis was performed on an AB SCIEX TOF/TOF™ 5800 Analyzer (AB Sciex/MDS Analytical Technologies [32]. Spectra in a mass range from 900 to 3700 Da (focus 1700 Da) were recorded and analyzed by GPS Explorer™ Software Version 3.6 (build 332, Applied Biosystems) and the Mascot search engine version 2.4.0 (Matrix Science Ltd, London, UK) using the RAST draft genome as reference.

Heterologous gene expression

The predicted Lis gene was isolated from genomic DNA of T. linaloolentis 47Lol by means of PCR, using the Phusion Polymerase according to the manufacturer manual (Life Technologies, Thermo Fisher Scientific, Waltham, USA) with the primer pair pLI_NdeI_FW (TCGTACATATGATGAGCAATATGGAATCG) and pLI_BglII_RV (CGATAGATCTTCAGTGGCCCGGCTTG, annealing temperature 59 °C). Additionally, a N-terminal truncated version of the gene was constructed with the primer pair pLI_NdeI_FW-truncated-N (TCGTACATATGATGCGCGGCGCCAAGC) and pLI_BglII_RV (annealing temperature 68 °C), which had an artificial start codon (ATG) and covered the amino acids 141–644 of the Lis. The genes were cloned into the pET42a overexpression plasmid and transformed into E. coli BL21(DE3). E. coli BL21(DE3) pET42-Lis or pET42-Lis-ΔN were grown in liquid LB medium at 37 °C and protein expression was induced by addition of 1 mM IPTG at an optical density (600 nm) of around 1. Cultures were further incubated at 30 °C for 4–5 h. Biomass was harvested by centrifugation (16000 × g, 25 min, 4 °C). Protein extracts were prepared as described above.

Geraniol isomerase activity

Lis activity was determined by end-point analysis for the thermodynamically favored reaction from geraniol to linlaool. Subfractions obtained during purification were dialyzed and adjusted to Tris-Cl buffer (40 mM, pH 8.0). Individual assays were prepared in 4 mL glass vials in an anaerobic chamber with N₂ headspace, containing 300–500 μL of sample and 5 mM dithionite as reducing agent. Samples were incubated for 20 min prior addition of 200 μL organic phase (200 mM geraniol in 2,2,4,4,6,8,8-heptamethylnonane, HMN). Vials were air-tight closed with butyl rubber stoppers and incubated for 14–16 h at 28 °C under mild shaking. Product formation was determined by gas chromatography with flame ionization detection (PerkinElmer Auto System XL, Überlingen, Germany). 1 μL of the HMN phase was injected onto an Optima-5 column (30 m × 0.32 mm, 0.25 μm film thickness; Macherey-Nagel, Germany) with hydrogen as carrier gas and the following temperature program: injection port 250 °C, detection port 350 °C, initial column temperature 40 °C for 2 min, increasing to 100 °C at a rate of 4 °C min⁻¹, keeping 100 °C for 0.1 min, followed by an increase to 320 °C at 45 °C min⁻¹ and hold for 3 min. The split ratio was set to 1:9.

The effect of detergents on Lis activity was tested for Triton X100 and Tween20 (0.5 %, 1 % w/v), CHAPS (0.1 % w/v) and n-octyl-α-D-glucoside (0.1 %, 0.5 %, 1 % w/v). Detergents were added to the soluble spheroplast fraction (protein concentration 0.1 mg mL⁻¹) and aforementioned enzyme assays were performed.

Reducing agents were tested with a dialyzed (Visking dialysis tubing 12–14 kDa cut-off, Serva) soluble protein extract (4 mg mL⁻¹ protein). The following reducing agents were added prior to the start of the assay: dithionite (2, 4 and 10 mM), dithiothreitol (2, 8 and 16 mM), cysteine (5 and 10 mM), or ferrous iron (5 mM).

Temperature dependency on Lis activity was determined between 12 and 50 °C. Samples (300 μL, 6.8 mg mL⁻¹ protein) were pre-incubated for 20 min at the individual temperatures prior to substrate addition. The assay was terminated after 8 h and analyzed by gas chromatography. Activation energy was calculated from the Arrhenius plot (y = −9664.3 x + 36.2; R² = 0.914).

The pH-optimum was determined by incubating crude cell lysate (20 mg mL⁻¹) in a pH-range from 7 to 9.5 in Tris-Cl (40 mM) applying the aforementioned enzyme assay.

Kinetic parameters (k_M and V_max) were determined for the most enriched enzyme fraction in biological duplicates (68 and 80 μg mL⁻¹ protein; 10 to 20 μg total protein in final assay). Samples were incubated with geraniol concentration from 0.125 to 4 mM, directly applied without carrier phase. Both substrate and enzyme were prepared separately with 7 mM dithionite and pre-incubated. Reactions were started by injecting an equal volume (200 μL) of enzyme to the substrate solution. Samples were incubated at 28 °C for 90 min and terminated by addition of 100 mM NaOH (final concentration). 1 μL of sample was directly subjected to GC analysis. Kinetic parameters were calculated from primary data plotted in a Michaelis-Menthen-graph.

Substrate specificity of the Lis was tested with geraniol, nerol and citronellol. A 400 μL-sample (active fraction after sucrose gradient, SP 4/5) was incubated with 200 μL of 200 mM geraniol, nerol and citronellol in HMN as well as with 200 μL of geraniol-nerol and geraniol-citronellol mixtures in HMN (100 mM each). Assays were prepared as aforementioned.

Stereoselectivity was tested with soluble protein extract (1.4 mg protein) and inner membrane-enriched fraction (1.6 mg protein) from spheroplast disintegration. Samples were treated with 5 mM dithionite and incubated with 10 mM geraniol under anaerobic conditions at 28 °C for 14 h and subsequently extracted with 200 μL n-hexane. Monoterpene analysis was performed by gas chromatography with flame ionization detector (Shimadzu GC-14A, Shimadzu Corporation) on a Hydrodex-ß-6TBDM column (25 m × 0.25 mm, Macherey-Nagel, Germany) with the following temperature program: injection port 200 °C, detection port 250 °C, initial column temperature 60 °C for 1 min, increasing to 130 °C at a rate of 5 °C min⁻¹, keeping 130 °C for 0.5 min, followed by an increase to 230 °C at 20 °C min⁻¹ and hold for 4 min.

Linalool isomerase activity

The forward reaction of the linalool isomerase - linalool to geraniol - was tested in a separate assay. 200 μL of enriched fraction after sucrose gradient centrifugation were treated with 5 mM dithionite and incubated with 1 μL (R,S)-linalool under anaerobic conditions at 28 °C for 0, 2 and 4 h. Samples were extracted with 200 μL n-hexane and analyzed by GC (Shimadzu GC-14A).

UV-VIS spectrum for cofactors

The most enriched, active protein sample (0.95 mg mL⁻¹ protein) was analyzed by UV-VIS spectroscopy (Beckman DU-640 spectrophotometer) in the range of 200–800 nm to detect cofactors.

Gene identification and bioinformatic analysis

A draft genome for T. linaloolentis 47Lol was obtained by merging data from two at NCBI public available draft genomes: ASM31020 (4.199 Mbp on 220 contigs, published 2012) and ASM62130 (4.214 Mbp on 46 contigs, published 2014). Contigs were automatically merged using Sequencher 4.6 with a minimum match percentage of 95 % and a minimum overlap of 50 bp. The resulting draft genome had 4.4 Mbp on 23 contigs and was uploaded to RAST for further analysis [33, 34]. Identification of a putative gene, coding for a linalool isomerase (Lis), was performed by homology search using the linalool dehydratase/isomerase sequence from Castellaniella degragrans 65Phen. The identified gene was analyzed by various bioinformatic tools: SignalP 4.1 for prediction of signal peptides [35], TMHMM, SOSUI and Philius for prediction of transmembrane helices [36–39] and the Pfam database to search for motifs and domain patterns [40].