Genotypes detection of TG

Five heterozygosis transgenic offspring of TGF-β2-kd lines were obtained. Four of them could generate offspring, which were designated as Founder 66, Founder 16, Founder 53 and Founder 41. The Tg mice with inserted fragment, identified by PCR, were regarded as positive Tg (Figure 1).

Protein expressional changes of TGF-β2 in multiple tissues of TG with different genotype

Results of Western blot, which detected in different multiple tissues of four genotypes TG (Founder 66, Founder 16, Founder 53 and Founder 41), indicated that TGF-β2 expressions were down-regulated by different percentages in the four kinds of TG mice (Figures 2 and 3). The rates of protein down-regulation were calculated as following: Rates of protein down-regulation = O.D. of WT- O.D. of Founder/O.D. of WT *100%. (O.D.: optical density).

Distributions of TGF-β2 in multiple tissues

Control of immunostaining specificity was performed by replacing the primary antibody with 2% goat serum. These controls did not exhibit any specific immune-staining in the olfactory bulb and brain (Figure 4S and T, respectively).

Animal generation

Animal use and care were in accordance with the animal care guidelines, which conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85–23, revised 1996).

TGF-β2 knock down (TGF-β2-kd) transgenic (Tg) mice with C57BL/6J genetic background were produced by our collaborators in The Institute of Laboratory Animal Science (Chinese Academy of Medical Sciences & Comparative Medicine Centre, Peking Union Medical College, Beijing, China). The generation of the transgenic mice was described as follows. Briefly, at least three silence expression sites of TGF-β2 were designed by software supplied by Invitrogen Company, USA. Then we selected predesigned short hairpin RNA (shRNAs) that target mouse TGF-β2 gene (Mus musculus, GeneID: 21808). The reconstruction plasmid was designed (Figure 5A) and purchased from Invitrogen Company. The constructed recombinant plasmid was transferred into 293T cells. The transformants were screened and identified by polymers chain reaction (PCR) detections and restriction analysis (Figure 5B, C and D).

The protocol of PCR is described as follows. The transgene was then isolated from the cloning plasmid and purified by Avr II digestion, followed by diluted to a final concentration of 5 ng/μL. The final transgenic fragment was microinjected into fertilized mouse eggs (F1 [C57BL/6 × CBA/J] × F1 [C57BL/6 × CBA/J]). Detection for the transgenic fragment is described as follows.

Transgenic mice were mated with nontransgenic partners to maintain heterozygozity of the transgene or with transgenic partners to generate homozygous transgenic offspring. In the latter case, transgenic male mice were test mated with two wild-type female mice, and the offspring (15–20 individuals) was analyzed by polymerase chain reaction (PCR). Male mice that produced exclusively transgenic offspring were considered homozygous for the transgene. TGF-β2-kd Tg mice and their age-matched, non-transgenic littermates (wild type mice) were used.

Real-time polymers chain reaction (RT-PCR)

The effects of shRNA target to TGF-β2 gene were detected by RT-PCR in transferred 293T cells. Total RNA was isolated from the harvested cells by using Trizol reagent (Invitrogen). cDNA was synthesized by using Oligo (dT) 18 and MMLV reverse transcriptase (Promega, Madison, WI). Primers employed were synthesized by Takara (Takara, Japan) and are described as follows. For detections in expression of TGF-β2 mRNA, the following primers were used: sense, 5′ CGGAGCATGGAAGTCACAG 3′; anti-sense, 5′ ACCACAGCCAGGAAACCC 3′. For GAPDH detections, the following primers were used: sense, 5′ CAAGGTCATCCATGACAACTTTG 3′; anti-sense, 5′ GTCCACCACCCTGTTGCTGTAG 3′. The cDNA was 10-fold serially diluted to seven concentrations for the standard curve.

RT-PCR protocol was applied using an ABI 5700 instrument (Bio-Rad). Reactions were performed in a 20 μl volume with 0.25 μM primers, 5 mM MgCl₂, nucleotides, Taq DNA polymerase, and buffers were included in the DNA Master SYBR Green I mix (Applied Biosystems). Specificity of amplification products was confirmed by melting curve analysis. PCR was performed by the denaturation step at 95°C for 3 minutes, followed by 35 cycles of 95°C for 10 seconds, 55°C for 10 seconds, and 72°C for 30 seconds. Fluorescent signals from PCR products were recorded at 85.5°C for 5 seconds. TGF-β2 mRNA levels were normalized as the ratio of the fluorescence intensity from TGF-β2 to that of GAPDH.

Semi-quantity PCR

Semi-quantity PCR analysis for the TGF-β2 expressions in transformants was performed. Prepare for RNA samples were described as above. Then the total RNA was eluted in 20 μl RNase-free Water (Gibco Life Technologies, Rockville, MD). The RNA was kept on ice and their concentrations were measured by a Nanodrop spectrophotometer (ND-1000). An equal amount of RNA (4 μg) was used for each experiment. The following primers were used: sense, 5′ CGGAGCATGGAAGTCA- CAG 3′; anti-sense, 5′ ACCACAGCCAGGAAACCC 3′. The product length of PCR is 512 bp. For GAPDH detections, the following primers were used: sense, 5′ CAAGGTCATCCATGACAACTTTG 3′; anti-sense, 5′ GTCCACCACCCTGTTGC- TGTAG 3′. The product length of PCR is 457 bp. Gene primers were synthesized by TaKaRa Company.

Experiments were duplicated to verify the results. For RNA amplification, the first-strand cDNA was synthesized from 4 μg of total RNA, using Revert AidTM First Strand cDNA Synthesis Kit (Fermentas Company, U.S.A.). PCR was then carried out using the PCR Master Mix Kit (Fermentas Company, U.S.A.) for 35 cycles, consisting of denaturation at 94°C for 1 min, annealing for 1 min, and extension at 72°C for 1 min. Then PCR products were electrophoresed in 1% agarose gel stained with ethidium bromide and visualized, using an ultra violet gel imager (BIO-GEL, BIP-RAD). The image analysis was performed by SYN Gene Tool (LIVE Science, U.S.A.).

Assessment of genotypes

The inserted fragment was identified by PCR. For TGF-β2-kd lines, the following primers were used: sense, 5′GAGCAAAGACCCCAACGAG 3′; antisense, 5′TTATGA- ACAAACGACCCAACAC 3′. The lengths of PCR product is 419 bp. Briefly, PCR was carried out using the PCR Master Mix Kit (Fermentas Company, U.S.A.) for 35 cycles, consisting of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. Then RT-PCR products were electrophoresed in 1% agarose gel stained with ethidium bromide and visualized, using an ultra violet gel imager (BIO-GEL, BIP-RAD). The image analysis was performed by SYN Gene Tool (LIVE Science, U.S.A.).

Expressions of TGF-β2 Protein in different TG mouse

To investigate the level of TGF-β2 protein, multiple tissues including the olfactory bulb, cortex, frontal lobe, basal forebrain, cerebellum, hypothalamus, medulla oblongata, spinal cord, trachea, lung, heart, liver, spleen, kidney, adrenal gland, intestines, skeletal muscles and epidermis were obtained from mice with different genic genotypes. After carefully rinsing in cooled PBS, the hippocampus from each was homogenized on ice in a Lysis Buffer containing 0.05 M Tris–HCl (pH 7.4, Amresco), 0.5 M EDTA (Amresco), 30% TritonX-100 (Amresco), NaCl (Amresco), 10% SDS (Sigma) and 1 mM PMSF (Amresco), and centrifuged at 12,000rp for 30 min. The supernatant was then obtained and stored at −80°C for later use. Protein concentration was assayed with BCA reagent (Sigma, St. Louis, MO, USA). A 20 μl aliquot of the samples was loaded on to each lane and electrophoresed on 12% SDS-polyacrylamide gel (SDS-PAGE) for 2.5 h at a constant voltage of 120 V. Proteins were transferred from the gel to a nitrocellulose membrane for 6.5 h at 24 V. The membrane was blocked with phosphate-buffered saline containing 0.05% Tween-20 (PBST) with 10% nonfat dry milk overnight at 4°C for 12 h, then the membrane was washed three times for 10 min each time. They were then rinsed with PBST and incubated with the primary antibody for TGF-β2 (1:1000, Chemican) at 4°C for 24 h. After washing 3 times for 10 min each, the membrane was incubated with a HRP-conjugated goat anti-rabbit IgG (1:5,000; Vector Laboratories, CA) for 2 h at room temperature, and washing as described above. The membrane was developed in ECM kit, and then pictured by Bio-Gel Imagining system equipped with Genius synaptic gene tool software. Densitometry analysis for TGF-β2 protein was performed. β-tubulin (1:500, Santa cruz) was used as internal control.

IHC

After anesthesia with 3.6% chloral hydrate (1 ml/100 g), mice were perfused with 150 ml of cold phosphate-buffered saline (PBS) for 5 min followed by 150 ml of 4% paraformaldehyde solution for 30 min. Multiple tissues described as above from each group was harvested, postfixed for 6-12 h, then immersed in 0.1 M PBS containing 20% sucrose overnight till the specimen sank to the bottom of the bottle. Sections of 20 μm thickness were cut in a freezing microtome (Leica CM1900, Germany), collected in a plate of 24 wells, rinsed with 0.01 M PBS three times, each for 5 min and soaked in PBS containing 3% H₂O₂ for 30 min at room temperature to block the endogenous peroxidase activity. After immersing in 0.01 M PBS containing 5% goat serum and 0.3% TritonX-100 solution at 37°C for 30 min, they were subsequently incubated at 4°C overnight with 2% goat serum containing goat polyclonal antibodies TGF-β2 (1:800, Santa Cruz). They were washed three times (5 min each time) in 0.01 M PBS containing 0.1% Tween-20 (PBST), and incubated in Reagents I and II from the PV-9000 Reagent Kit (Chemicon, Anti-Rabbit/Mouse Poly-HRP IHC Detection Kit, USA), each for 30 min at 37°C. It was again rinsed five times, each for 5 min in 0.01 M PBST. Finally, sections were detected by DAB staining. Negative control was performed by replacing the primary antibody with 2% goat serum to ascertain the specificity of antibody staining. IR products were observed and photographed with a light microscope (Leica. DMIRB, Germany) coupled with a computer assisted video camera.