Skip to main content

Table 3 Oligonucleotide primers used for mutating Klebsiella sp. 601 MCO gene

From: Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates

Oligo name Sequence
106F-F 5'-ACTGGCATGGCCTGTTT GTCCCGGGCGAGGTC-3'
106F-R 5'-CCTCGCCCGGGACAAA CAGGCCATGCCAGTG -3'
Δα351-378- F 5'- GGGCTGACGCAGCGTCAG ATGGACCACGGCATGATGGA -3'
Δα351-378- R 5'-CTGACGCTGCGTCAGCCC CGTCAGGGACGGT -3'
α351-380M-F1 5'-GATCCGATGCTCGACGGAGGA GGCATGCAGGCGGGAGGACCT AAGTATGGC GACCAG-3'
α351-380M-R1 5'-CTGGTCGCCATACTTAGGTCCTCC CGCCTGCATGCCTCCTCC GTCGAGCAT CGGATC-3
α351-380M-F2 5'-TATGGCGACCAGGCGAAA GCGGGACCT GACCACGGCATGATG -3'
α351-380M-R2 5'-CATCATGCCGTGGTCAGG TCCCGCTTT CGCCTGGTCGCCATA -3'
  1. * Underlining indicates the sequences pairing between the forward and reverse primers for the deletion of α351-378. Mismatch bases are bold in each oligonucleotide.