Table 1 Summary of DNA oligonucleotides used to prepare the plasmid constructs, molecular masses, extinction coefficients, and yields of the purified IRBP-thioredoxin fusion proteins. Except for module 4, which was cloned directly into the expression plasmid from a previously described cDNA (XenB1) (Gonzalez-Fernandez et al., 1993 J. Cell Sci. 105:7–21), cDNAs for IRBP and its individual modules were amplified by PCR from the full-length cDNA isolated in the present study. For each primer pair, the sense primer is written above the antisense primer. Regions of each primer corresponding to the plasmid multiple cloning segment are: acaaggtacccggggatcct (sense), and cttaaggtcgactctagagg (antisense). For each sense primer, the codon corresponding to the first amino acid residue of each module is underlined. For the antisense primer the stop codon is underlined.

From: Module structure of interphotoreceptor retinoid-binding protein (IRBP) may provide bases for its complex role in the visual cycle – structure/function study of Xenopus IRBP