Skip to main content

Table 1 Summary of DNA oligonucleotides used to prepare the plasmid constructs, molecular masses, extinction coefficients, and yields of the purified IRBP-thioredoxin fusion proteins. Except for module 4, which was cloned directly into the expression plasmid from a previously described cDNA (XenB1) (Gonzalez-Fernandez et al., 1993 J. Cell Sci. 105:7–21), cDNAs for IRBP and its individual modules were amplified by PCR from the full-length cDNA isolated in the present study. For each primer pair, the sense primer is written above the antisense primer. Regions of each primer corresponding to the plasmid multiple cloning segment are: acaaggtacccggggatcct (sense), and cttaaggtcgactctagagg (antisense). For each sense primer, the codon corresponding to the first amino acid residue of each module is underlined. For the antisense primer the stop codon is underlined.

From: Module structure of interphotoreceptor retinoid-binding protein (IRBP) may provide bases for its complex role in the visual cycle – structure/function study of Xenopus IRBP

Protein Primer Sequence or cDNA Vector (E. coli) Induction Temp, time* KDa† ε (M-1 cm-1)‡ Yield (per liter E. coli)
Full-length IRBP ttc cagccttctttggtaattta tcgtctgccctctaatt pThioHis (Top10) 30°C, 5 hrs 148 131,420 7 mg (47 nmoles)
Module 1 ttc cagccttctttggtaattgaacgcacagcaaggatag pThioHis (Top10) 20°C, 21 hrs 47 48,010 15 mg (320 nmoles)
Module 2 tct gttacccatgtcttgcatgggatgaaatgcaatgatct pThioHis (Top10) 30°C, 21 hrs 49 39,640 20 mg (410 nmoles)
Module 3 agt atatttccattagtcaagggctgtacgcagtttaataatgcg pTrxFus (GI698) 30°C, 5 hrs 50 60,100 22 mg (460 nmoles)
Module 4 XenB1 pTrxFus (GI724) 35°C, 4 hrs 50 48,010 16 mg (320 nmoles)
  1. * Calculated from the translated amino acid sequence including the thioredoxin fusion protein.
  2. The temperature and duration of protein induction was determined empirically from pilot studies.
  3. ‡ Molecular masses and protein extinction coefficients (ε) were calculated from the amino acid sequences and include the thioredoxin fusion protein (Gill and Von Hippel, 1989 Anal. Biochem. 182:319–326).