Figure 3From: The role of the Zn(II) binding domain in the mechanism of E. coli DNA topoisomerase IBinding of Top67 and ZD to single-stranded and double-stranded DNA. The gel mobility shift assay was used to compare the binding affinities. The substrates used are (a): single-stranded 5'GAAAACTCACAGGAAGCGGCCGAAGCGATTCGTCC 3'; (b): the same labeled strand of hybridized to its complementary strand. Open circles: Top67; solid circles: ZD.Back to article page