Skip to main content

Table 3 Oligonucleotide sequences used for construction of expression vectors

From: Recombinant expression and functional analysis of proteases from Streptococcus pneumoniae, Bacillus anthracis, and Yersinia pestis

Name Oligonucleotide sequence
PX006 GGGGCACGTGGGTATGAAAATCGAAGAAGGTAAACTG
PX007.2 CTGGAAGTACAGGTTCTCACCGCTCGAATTAGTCTGCGCGTC
PX0041 GGGGCACGTGACCACCCTGGAAGTACAGGTCTC
PX0020 GGGGCCATGGCAATGAAAATAAAAACAGGTGCACGCA
PX0021 GTGATGGTGGTGGTGATGACCCGAACCGCTCGAGCTCGAATTAGTCTGCGC
PX0023 GGGGCCATGGCTATGAAAAAGATTTGGCTGGCGCTGG
PX0024 GTGATGGTGGTGGTGATGACCCGAACCGCTAGTTGATCCTTTTTTCTCGCTTAAGTATTTCAC
PX0029 GGGGGGTACCACCACCCTGGAAGTACAGGTTCTCACCGGCCGAGTGATGGTGGTGGTGAT