Skip to main content

Table 1 Oligonucleotides used in this study for cloning of the genes cur_1714 and cur_1715. The sequences of the primers were derived from the prospective genes cur_1714 and cur_1715 and their flanking regions taken from the genome of C. urealyticum DSM 7109 [13]

From: Identification and characterization of smallest pore-forming protein in the cell wall of pathogenic Corynebacterium urealyticum DSM 7109

Oligonucleotides Sequence 5’➝ 3’
Fwd_1714_XbaI GTGTCTAGAGACCTACACTCTAGGAGTTTC
RP pX cur_1714 KpnI CTGGTACCTTAGAAGCCGAATGCCTG
RP-cur1714-KpnI pXHis GCTTAAAGGTACCGAAGCCGAATG
RevpXMJ19 CAGACCGCTTCTGCGTTCTG
Fwd Gst 1714 BamHI CTGAGGATCCGGTAACGCAAC
Rev Gst 1714 EcoRI GACGAATTCTTAGAAGCCGAATGC
Fwd Gst 1715BamHI CAGTGGATCCAACGTCGACATG
Rev Gst 1715 EcoRI CTAGAATTCCTACTTGTTCTCGG
Fwd GST Seq CACTCCCGTTCTGGATAATG
Rev GST Seq CACTCCGCTATCGCTACGTGAC
T7 Promotor TAATACGACTCACTATAGGG
M13 reverse CAGGAAACAGCTATGAC
  1. Recognition sites for the restriction enzymes are underlined