Skip to main content

Table 1 list of primers used in this study

From: Copper chelation and interleukin-6 proinflammatory cytokine effects on expression of different proteins involved in iron metabolism in HepG2 cell line

primer Sequence 5′ → 3′ Reference
Fpn1AB Reverse CATCCTCTCTGGCGGTTGTG This study
Fpn1A Forward TCCATAAGGCTTTGCCTTTCC This study
Fpn1B Forward GCATCTGGTTGGAGTTTCAAT This study
GPI-Cp Reverse GATTGGGTAGATCACATTCC [90]
sCp Reverse CCAATTTATTTCATTCAGCC [90]
CP Forward GTCTTTGACCTTATCCCTGG This study
HAMP Forward ATGGCACTGAGCTCCCAGAT This study
HAMP Reverse TTGCAGCACATCCCACACTTT This study
β-actin Reverse CACATCTGCTGGAAGGTGGA This study
β-actin Forward CATGAAGTGCGACGTTGACA This study
  qPCR Primers  
TNF-α Forward GCAGGTCTACTTTGGGATCATTG A generous gift of prof. A. Mastinoa
TNF-α Reverse GCGTTTGGGAAGGTTGGA A generous gift of prof. A. Mastinoa
IL1B Forward GCGAATGACAGAGGGTTTCTTAG A generous gift of prof. A. Mastinoa
IL1B Reverse CACCTTCAGCTGCCCAGACT A generous gift of prof. A. Mastinoa
β-actin Forward CATTCCAAATATGAGATGCGTTGT This study
β-actin Reverse TGTGGACTTGGGAGAGGACT This study
  1. aDepartment of Chemical Biological Pharmaceutical and Environmental Sciences, University of Messina, Italy