Skip to main content

Table 1 Bacterial strains, plasmids, and oligonucleotide primers.

From: Characterization and site-directed mutagenesis of Wzb, an O-phosphatase from Lactobacillus rhamnosus

Strain, plasmid, or primer Relevant characteristic(s) or sequence (5' to 3') Source, reference or target
Strains   
L. rhamnosus ATCC 9595 Low EPS-producing (116 mg/L) ATCC1
E. coli XL1-Blue Cloning host (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F' proAB lacIqZ ΔM15 Tn10]) Stratagene1
E. coli NM522 Cloning host (supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5 (rK- mK-) [F' proAB lacIqZ ΔM15]) Stratagene1
Plasmids   
   pQE30 His-tag fusion protein expression vector; Cmr, Amr Qiagen1
   pGL387 768-pb digested PCR fragment (wzb) cloned into the Sac I-Kpn I site of pQE30 This study
Primers 2   
   BF1SacI gagctcATTGATGTGCATTGCCATATGTTACCGGGA PCR of wzb
   BRSKpn ggtaccTTAATACCGCGACAACAAACGCTTTTCAACC PCR of wzb
   BD4NF ATTAATGTGCATTGCCATATGTTACCGGGA wzb-D3N forward
   BD4NR TCCCGGTAACATATGGCAATGCACATTAAT wzb-D3N reverse
   BFHI ATTGATGTGGCTTGCGCTATGTTACCGGGA wzb-H5A-H7A forward
   BRHI TCCCGGTAACATAGCGCAAGCCACATCAAT wzb-H5A-H7A reverse
   BC6SF ATTGATGTGCATAGCCATATGTTACCGGGA wzb-C6S forward
   BC6SR TCCCGGTAACATATGGCTATGCACATCAAT wzb-C6S reverse
   BH42AF TGATGACGCCGGCCGCTATGAATGGCCG wzb-H42-H43A forward
   BH42AR CGGCCATTCATAGCGGCCGGCGTCATCA wzb-H42-H43A reverse
   BD64NF GTTTCAAAACGAGTTAGACCGCCGCAATATTCCA wzb-D64N forward
   BD64NR TGGAATATTGCGGCGGTCTAACTCGTTTTGAAAC wzb-D64N reverse
   BR68AF GTTTCAAGACGAGTTAGACGCCCGCAATATTCCA wzb-R68A forward
   BR68AR TGGAATATTGCGGGCGTCTAACTCGTCTTGAAAC wzb-R68A reverse
   BR69AF GTTTCAAGACGAGTTAGACCGCGCCAATATTCCA wzb-R69A forward
   BR69AR TGGAATATTGGCGCGGTCTAACTCGTCTTGAAAC wzb-R69A reverse
   BC78SF TTTCCCGAGTCAGGAAGTGCGGATTAATGGGC wzb-C78S forward
   BC78SR GCCCATTAATCCGCACTTCCTGACTCGGGAAA wzb-C78S reverse
   BFH197A CCTCTGATGCCGCTGCCTTACCGGGTCGCAGTTA wzb-H197-H198A forward
   BRH197A TAACTGCGACCCGGTAAGGCAGCGGCATCAGAGG wzb-H197-H198A reverse
  1. 1 ATCC (American Type Culture Collection, Manassas, VA, USA); Qiagen S.A. (Courtaboeuf, France); Stratagene (LaJolla, CA, USA).
  2. 2 Restriction sites in primers are indicated in lower case letters.