Skip to main content

Table 2 Real-time quantitative PCR sequence information

From: Biosynthesis and release of pheromonal bile salts in mature male sea lamprey

Gene ID NCBI accession no. Sequence for real-time quantitative PCR
cyp7a1 PMZ0014378-RA CAACATGTCGGCGCTCATC GCCCTCCGAATACAACTCA ATGACACGCTGTCTCGCATG
cyp27a1 PMZ0003691-RA TCTGGCCAAAATGTCATTCCT TAAGGCTGTCATCAAAG AGATTCTCAGACTGTATCCAGTGGTGCC
cyp8b1 PMZ0014367-RA TCCCCTTGATAAAGGCCTCAT CCCATGGCTGGGCCACGCCATCGAGTTCCGGAGGGA CATGTACGCCTTCCTGCGG
bsep PMZ0007614-RA GTGTCTCAGGAGCCGGTGTT GTTCGACTGCAGCATTG CCGACAACATTCGCTACGGTGCC
slc10a1 PMZ0014657-RA CTGTCCCGGAGGGAACCT CTCCAACGTGTTCGCGCTGGCGCTCGACGGAGACATGAA CCTCAGCATCCTCATGACCACGTG
slc10a2 PMZ0006503-RA GCTGGCGCTGGTGATGTT CGCCATGGGCTGCACGGTGCAGATTCACAA GGTGATTGCTCACCTTCGCAATCC
hsd3b7 PMZ0008058-RA CGGCCGTTCTACAAGTTCGT CCCACCCATCAACCGTCAGCTCGT GGTCATGGTCAACACGCACTTCA
sult2b1 PMZ0018743-RA GGAACGTTCATGCGAAAAGG CGCAGTTGGCAACTGGAAAAG TGAATTCACCGTGGCGTTGA
sult2a1 PMZ0001223-RA TGGTCACCTACCCCAAATCAG GCACGACGTGGATGCAGGAGA TCGTGACCCTGGTGTATAGCGACGGGGACCTG
sult1c1 PMZ0016497-RA CCGTGATGCGCGACAAC CCCATGACGAATTACAGCACCTTGCC CACCGACTTCTTGGACCACTCCGTG
40s PMZ0000703-RA ACCTACGCAGGAACAGCTATGAC CATCTCGAGCAGCTGAA GCTCCAATGTGGTGGAATTCGTCG
  1. Partial sequences selected for amplification in RTQ-PCR experiments are shown, along with the NCBI accession number for each gene. Italicized sequences indicate the 5 and 3 primers for each gene. Sequences used for TaqMan MGB probes are shown in bold font. Note that the 3′ primer is the reverse compliment of the sequence shown above.