Skip to main content

Table 1 List of primers used for mutagenesis

From: Phosphatidylcholine formation by LPCAT1 is regulated by Ca2+ and the redox status of the cell

Purpose Primer sequence (5′ to 3′)
saturated mutagenesis of GCCTCAGATAATGATTTTTCCAGAAGGAACTNNKACAAA-
Cys-211 codon TAGGACCTGCCTCA
Cys-211 to Ser GATTTTTCCAGAAGGAACTAGTACAAATAGGACCTGCCT
Glu-403 to Ala TGAGATTGACCTTCGTGCATATGTGGTCGCCTTGT
Cys-216 to Ala GAACTGCTACAAATAGGACCGCCCTCATTACCTTCAAACCTG
Cys-263 to Ala AATCCTGTGGCTCACTCTGGCCCAGTTTCAAAACCAAGTG
Cys-278 to Ala GTGGAAATTGAATTTCTGCCTGTGTATGCCCCTTCTGAAGAGG
Cys-314 to Ala ACTATACATTTGAGGACGCCCAGCTGGCTCTGGCAG
Cys-330 to Ala CTTGCCTGCTGACACCGCCCTGCTAGAGTTTGCC
Cys-401 to Ala GCCTTGTCTGTGGTGGCCAGGCCATCCCAGAC
Cys-443 to Ala GAGGCCAACCTGTCCGCCATCCTCAAGACTGC
Cys-477 to Ala AATCACCTTTGATGACTTCGCCGGGTTTGCGGAAATGTAC
Cys-501 to Ala GACACATTTCGACAGCGCTGCACAGACACCCCCA
Cys-514 to Ala CAACTCCCAATGGCTTCGCCATTGACTTCAGCCCTG
Cys-530 to Ala ACTTTGGGAGAAAGAATTCTGCTAAGAAAGCGGACTAGCCTC