Skip to main content

Table 5 PCR primers used in this study

From: The Peroxisomal Targeting Signal 1 in sterol carrier protein 2 is autonomous and essential for receptor recognition

Primer name 5'-3' sequence
HsPex5p: R608Wf CATCTGGAGCACCCTGTGGTTGGCATTGTCTATGTTAGG
HsPex5p: R608Wr CCTAACATAGACAATGCCAACCACAGGGTGCTCCAGATG
HsPex5p: D624Wf CCTATGGGGCAGCCTGGGCGCGGGATCTGTC
HsPex5p: D624Wr GACAGATCCCGCGCCCAGGCTGCCCCATAGG